![]() |
![]() |
This tasks allows you to create primer pairs for one or more sequences according to specifications like length, melting point, etc.
The algorithm will try to find primers that match most of your constraints, while still trying to cover as much of the given sequence as possible. It employs a nearest-neighbor-method for calculating the melting point and will avoid unwanted primer properties like poly-nucleotide stretches, loop formation or primer dimers.
| Sequence selection | |
|---|---|
| Choose from your previously uploaded sequences | Select a sequence file from the list of your personal sequence files. |
| or enter the formatted DNA sequence | Enter your correctly formatted sequence(s) directly into
the form, e.g. with copy and paste. The following formats are accepted: Sequences should not contain IUPAC characters! |
| or upload a file containing sequence(s) | If your browser supports this option, a sequence file can be uploaded. If you use this option, the file should contain the sequence(s) in either one of the following formats: |
| Primer parameters | |
|---|---|
| Length constraints for primers |
The minimum and maximum length of the primer sequences to be selected. The optimum length field (more options mode only) allows you to choose a preferred value within the given interval. |
| GC content |
The minimum and maximum content of G or C nucleotides allowed for the primer sequences. The optimum GC field (more options mode only) allows you to choose a preferred value within the given interval. |
| Melting temperature |
The minimum and maximum melting temperature allowed for the primer sequences. The melting temperature is calculated using a nearest-neighbor model as described by Rychlik et al. Please note that it is a predicted value. You might still get different results in a wet-lab experiment! The optimum melting temperature field (more options mode only) allows you to choose a preferred value within the given interval. The maximum melting temperature difference defines the maximum difference between the melting temperatures of the 5' and 3' primers of a single product. |
| Melting temperature calculation |
The DNA and salt concentration used in the melting temperature prediction can be changed here. The default values are 50 mMol for the salt concentration and 0.25 nMol for the DNA concentration. If you use different concentrations for your experiments, entering them here will result in even better melting temperature predictions. These parameters are hidden by default. You can use the
|
| Product length |
The minimum and maximum length of the products. The optimum product length field (more options mode only) allows you to choose a preferred value within the given interval. The algorithm will try to cover the submitted sequence(s) with as many adjacent products within these length constraints. Wherever possible, overlap is avoided. |
| Primer uniqueness (only available at www.genomatix.de) |
Selecting one of these options will check your primers for uniqueness against the selected genome.
|
| Email address | Here you can choose between two methods for receiving
the results:
The results will be available for a limited time on our server. For details of how long your results will be kept please see the result-email. After that period they will be deleted unless protected in the project management! |
| scya3_ccl3_nm_011337_+_3utr: | |||||||
|---|---|---|---|---|---|---|---|
| primer sequence | start | end | length | GC% | Tm in °C | count | mismatches |
| Primer pair 1: | |||||||
| CCAACTTCCATTCACAGCTTCC | 10 | 31 | 22 | 0.50 | 55.11 | 1 | 0 |
| Distance: 249 | |||||||
| CCATCTCCCTCCCAGTTGGTCA | 237 | 258 | 22 | 0.59 | 59.58 | 1 | 0 |
Product:>scya3_ccl3_nm_011337_+_3utr_prod_1 CCAACTTCCATTCACAGCTTCCTATTCTTTGCTGTTATTCCTCTTAACCAGTAAGTCTGACTTTCCAGAA AAATAAAAATAAAATAAAATAAAATAAAACTCAACACCAGTCACTTGTTAAAGGGCATATTTATTACTTC TCTGGTATAAACAAAGCATCTATTGTACATTTGTCAGTTCATGACTTTGTCATCATGTCTACCTAGAATA GCTGTCACCAAACAGTGTGACCAACTGGGAGGGAGATGG |
|||||||
| Primer pair 2: | |||||||
| GGGTTGAGGAACGTGTCCTGAA | 259 | 280 | 22 | 0.55 | 57.52 | 1 | 0 |
| Distance: 238 | |||||||
| TCCATGGGTCCCGTGTAGAGCA | 475 | 496 | 22 | 0.59 | 60.96 | 1 | 0 |
Product:>scya3_ccl3_nm_011337_+_3utr_prod_2 GGGTTGAGGAACGTGTCCTGAAGTCTTTCAGAATAAATAGTCACAAATACAAGTATGACAATAAAATAAA TTACAAAATTAAATAGTATTAAACCAATAGGATTAAATTAAATAAAATTTCAAGTGAAGAGTCCCTCGAT GTGGCTACTTGGCAGCAAACAGCTTATAGGAGATGGAGCTATGCAGGTGGCAGGAATGTTCCGGGGCTCA AGCCCCTGCTCTACACGGGACCCATGGA |
|||||||
| © 1998-2011 Genomatix Software GmbH - All rights reserved |