Primer search: create primer pairs from one or more sequences

[Introduction] [Sequence Selection] [Parameters] [Output]

Introduction

This tasks allows you to create primer pairs for one or more sequences according to specifications like length, melting point, etc.

The algorithm will try to find primers that match most of your constraints, while still trying to cover as much of the given sequence as possible. It employs a nearest-neighbor-method for calculating the melting point and will avoid unwanted primer properties like poly-nucleotide stretches, loop formation or primer dimers.

Sequence Selection

Sequence selection
Choose from your previously uploaded sequences	Select a sequence file from the list of your personal sequence files.
or enter the formatted DNA sequence	Enter your correctly formatted sequence(s) directly into the form, e.g. with copy and paste. The following formats are accepted: plain sequence format EMBL FASTA GCG, RSF (several sequences) GenBank IG Sequences should not contain IUPAC characters!
or upload a file containing sequence(s)	If your browser supports this option, a sequence file can be uploaded. If you use this option, the file should contain the sequence(s) in either one of the following formats: plain sequence format EMBL FASTA GCG, RSF (several sequences) GenBank IG

Primer search Parameters

Primer parameters
Length constraints for primers	The minimum and maximum length of the primer sequences to be selected. The optimum length field (more options mode only) allows you to choose a preferred value within the given interval.
GC content	The minimum and maximum content of G or C nucleotides allowed for the primer sequences. The optimum GC field (more options mode only) allows you to choose a preferred value within the given interval.
Melting temperature	The minimum and maximum melting temperature allowed for the primer sequences. The melting temperature is calculated using a nearest-neighbor model as described by Rychlik et al. Please note that it is a predicted value. You might still get different results in a wet-lab experiment! The optimum melting temperature field (more options mode only) allows you to choose a preferred value within the given interval. The maximum melting temperature difference defines the maximum difference between the melting temperatures of the 5' and 3' primers of a single product.
Melting temperature calculation	The DNA and salt concentration used in the melting temperature prediction can be changed here. The default values are 50 mMol for the salt concentration and 0.25 nMol for the DNA concentration. If you use different concentrations for your experiments, entering them here will result in even better melting temperature predictions. These parameters are hidden by default. You can use the next to the section header to reveal them!
Product length	The minimum and maximum length of the products. The optimum product length field (more options mode only) allows you to choose a preferred value within the given interval. The algorithm will try to cover the submitted sequence(s) with as many adjacent products within these length constraints. Wherever possible, overlap is avoided.
Primer uniqueness (only available at www.genomatix.de)	Selecting one of these options will check your primers for uniqueness against the selected genome. check for exact copies: With this option selected, the program will try to avoid primers that are not unique. Primers occurring 4 times or more often will be discarded. We allow 2 or 3 occurrences to alleviate the fact that some genes, while probably not duplicate in the genome, can be found more than once in the current genome sequence databases. Unique primers will be preferred, however. check for copies with one mismatch: This option will avoid all primers that can be found more than 10 times in the selected genome with a single mismatch. This will reduce spurious binding of the primers even further. Depending on the submitted sequence(s) and your search parameters this option will extend the run-time of the task considerably!
Email address	Here you can choose between two methods for receiving the results: Show result directly in browser window In this option the URL of the result is directly shown in your browser window. Warning: Please use this option only for analyses which can be performed in a short time. If the analysis takes longer than the timeout of the webserver, the connection will be terminated and you will receive an error message (e.g. "The document contained no data."). In this case, the results will not be available, please restart the analysis using the option below "Send the URL of the result to". Send the URL of the result via email In this option an email with the URL of the results will be sent to the user provided email address, when the analysis is finished. The results will be available for a limited time on our server. For details of how long your results will be kept please see the result-email. After that period they will be deleted unless protected in the project management!

Output Example

Example of primer search output:

scya3_ccl3_nm_011337_+_3utr:
primer sequence	start	end	length	GC%	Tm in °C	count	mismatches
Primer pair 1:
CCAACTTCCATTCACAGCTTCC	10	31	22	0.50	55.11	1	0
Distance: 249
CCATCTCCCTCCCAGTTGGTCA	237	258	22	0.59	59.58	1	0
Product: >scya3_ccl3_nm_011337_+_3utr_prod_1 CCAACTTCCATTCACAGCTTCCTATTCTTTGCTGTTATTCCTCTTAACCAGTAAGTCTGACTTTCCAGAA AAATAAAAATAAAATAAAATAAAATAAAACTCAACACCAGTCACTTGTTAAAGGGCATATTTATTACTTC TCTGGTATAAACAAAGCATCTATTGTACATTTGTCAGTTCATGACTTTGTCATCATGTCTACCTAGAATA GCTGTCACCAAACAGTGTGACCAACTGGGAGGGAGATGG

Primer pair 2:
GGGTTGAGGAACGTGTCCTGAA	259	280	22	0.55	57.52	1	0
Distance: 238
TCCATGGGTCCCGTGTAGAGCA	475	496	22	0.59	60.96	1	0
Product: >scya3_ccl3_nm_011337_+_3utr_prod_2 GGGTTGAGGAACGTGTCCTGAAGTCTTTCAGAATAAATAGTCACAAATACAAGTATGACAATAAAATAAA TTACAAAATTAAATAGTATTAAACCAATAGGATTAAATTAAATAAAATTTCAAGTGAAGAGTCCCTCGAT GTGGCTACTTGGCAGCAAACAGCTTATAGGAGATGGAGCTATGCAGGTGGCAGGAATGTTCCGGGGCTCA AGCCCCTGCTCTACACGGGACCCATGGA

Explanations:

For each sequence you'll get a table listing the primer pairs together with their product.
The first primer is always given in 5'-3'-direction with regard to the input sequence, the second primer is given in 3'-5'-direction.
start and end report the primer location within the input sequence.
The distance between the primers is measured between the start of the first and the end of the second primer. It is also the length of the product.
length, GC % and Tm in °C list the values for the length, GC content and predicted melting temperature of each primer.
count lists the number of occurrences of the primer within the genome of the selected organism. This should usually be 1. However, if your sequence is not from the current genome assembly of the selected organism (because it is from an older release, or a proprietary sequence from an experiment) the value might be 0. If this happens you'll get a warning that one or more primers couldn't be found in the selected organism's genome. If both primers for a product have a higher value than 1 you should they might produce additional products!!
mismatches lists the number of occurrences of the primer with a single nucleotide mismatch. These might well bind to the DNA, so if you get a high number of mismatches for both primers of a product, there's a chance that you'll get additional products as well.