![]() |
![]() |
SequenceShaper is a software tool developed for the design
of regulatory sequences. It allows the generation and deletion of transcription
factor binding sites.
The analysis is divided into two steps.
| Sequence Selection | |
|---|---|
| Sequence data | The program expects a single DNA sequence. The sequence can be supplied
in either one of the following formats:
|
| Matrix Parameters | |
|---|---|
| Matrix group | The selection here corresponds to the MatInspector settings. The sequence is scanned for matches to the selected MatInspector matrix group. The binding sites detected form the sequence context used in step 2 of the analysis. The lower the core and matrix similarities the more binding sites are included in the sequence context. This restricts the number of possible mutations that do not influence these binding sites. |
| Parameters | |
|---|---|
| Generate new binding site | Matrix selection:
Select either a single matrix or a matrix family describing the binding site you want to generate from the respective lists. Further parameters for the new binding site are the strand orientation, the core similarity and the matrix similarity. If the program does not find any possible mutations these thresholds should be decreased. |
| Sequence region the binding site will
be inserted:
The user has to define the start and the length of the sequence region the new binding site has to be generated in. The length of the sequence region may exceed the length of the selected binding site. |
|
| Select the binding sites you want to delete | SequenceShaper allows the simultaneous deletion of several binding sites.
For each site selected a list of possible mutations restricted by the parameters
defined in the next step is determined. If the boundaries of some of the
selected binding sites overlap additional mutations are determined which
destroy the binding sites simultaneously. If SequenceShaper is used with matrix families potential binding sites for all family members will be deleted. |
| Define parameters for the binding sites you want to delete | Remaining thresholds for deleted
site:
These thresholds for core and matrix similarity define the maximum
score each binding site may have after the mutations were introduced. |
| Restrictions | Max. number of mutations:
Usually 2 or 3 mutations result in several suggestions for mutations to generate/delete a binding site. In the case of overlapping binding sites it might be necessary to allow 4 mutations at the same time. |
| Don't delete any other site:
If this option is selected none of the binding sites from the sequence context may be deleted. Binding sites overlapping with the generated/deleted binding site may be changed in their binding affinity (increase or decrease of matrix similarity). If the sequence context was determined using matrix families, these binding sites may be also replaced by other members of the matrix family. |
|
| Don't insert additional site:
This option prevents the generation of additional binding sites which were not part of the sequence context before the insertion of the mutations. |
|
| Conserve open reading frame (ORF):
With this option SequenceShaper only suggests mutations which do not influence the amino acids coded by the sequence. As this restricts the analysis to silent mutations it might be necessary to increase the maximum number of mutations allowed. The ORFs refer to the beginning of the sequence submitted and not to the analyzed transcription factor binding sites. |
|
| Output | Max. number of solutions suggested
for single sites:
Enter the maximum number of mutations suggested in the output file for each selected site. |
| Show only solutions with a minimal number of mutations:
If this option is activated only those mutations are listed in the output which use a minimal number of nucleotide substitutions, e.g. if 3 nucleotide substitutions per binding site were allowed but there are solutions using only two of them only these mutations are shown. |
|
| Max. number of solutions suggested for overlapping sites:
Enter the maximum number of mutations suggested in the output file for each group of overlapping binding sites. As the deletion of overlapping binding sites is the most complex and therefore the most time consuming part of the analysis this number should be increased only carefully. |
|
| Email address | Here you can choose between two methods for receiving
the results:
The results will be available for a limited time on our server. For details of how long your results will be kept please see the result-email. After that period they will be deleted unless protected in the project management! |
The output of SequenceShaper contains a list of possible mutations fulfilling the restrictions given by the user. The following example shows the results of an analysis of a 719bp promoter sequence.
| Restrictions: |
| Max. number of mutations: 3 |
| Don't delete other site |
| Don't generate other site |
| Conserve ORF2 |
| V$PARF | (381 - 395) | |
| Core sim.: | 0.70 | |
| Matrix sim.: | Opt.-0.20 | |
| V$PIT1 | (384 - 394) | |
| Core sim.: | 0.70 | |
| Matrix sim.: | Opt.-0.20 |
| Suggested Mutations | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| original Sequence | atggggatggaggctctttgccaccagtcc cagttttatgcatgg cagctctaatgacaggatggtcagccctgc | ||||||||
| (T384A) (T386A) (T387A) (A388C) | atggggatggaggctctttgccaccagtcc cagataactgcatgg cagctctaatgacaggatggtcagccctgc | ||||||||
| affected restriction sites | lost: CjeI BfiI BsrI AvaIII new: none |
||||||||
| (T384A) (T386A) (T387C) (A388C) | atggggatggaggctctttgccaccagtcc cagatacctgcatgg cagctctaatgacaggatggtcagccctgc | ||||||||
| affected restriction sites | lost: CjeI BfiI BsrI AvaIII new: BspMI |
||||||||
| (T384A) (T386A) (T387G) (A388C) | atggggatggaggctctttgccaccagtcc cagatagctgcatgg cagctctaatgacaggatggtcagccctgc | ||||||||
| affected restriction sites | lost: CjeI BfiI BsrI AvaIII new: BbvI AluI CviJI Fnu4HI TseI |
||||||||
| (T384A) (T386A) (A388C) | atggggatggaggctctttgccaccagtcc cagatatctgcatgg cagctctaatgacaggatggtcagccctgc | ||||||||
| affected restriction sites | lost: CjeI BfiI BsrI AvaIII new: EcoRV |
||||||||
Each mutation listed in the output tables is preceded by a check box. Sequences selected by these check boxes can be written to a file using the button at the bottom of the result tables.
| © 1998-2011 Genomatix Software GmbH - All rights reserved |