Genomatix-Logo
Overview of Help-Pages

DNA Sequence formats


[Plain] [EMBL] [FASTA] [GCG] [GenBank] [IG] [IUPAC]
[How Genomatix represents sequence annotation]

Plain sequence format

A sequence in plain format may contain only IUPAC characters and spaces (no numbers!).

Note: A file in plain sequence format may only contain one sequence, while most other formats accept several sequences in one file.

An example sequence in plain format is:

ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCC
CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGC
CTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGG
AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCC
CTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAG
TTTAATTACAGACCTGAA

EMBL format

A sequence file in EMBL format can contain several sequences.
One sequence entry starts with an identifier line ("ID"), followed by further annotation lines. The start of the sequence is marked by a line starting with "SQ" and the end of the sequence is marked by two slashes ("//").

An example sequence in EMBL format is:

ID   AB000263 standard; RNA; PRI; 368 BP.
XX
AC   AB000263;
XX
DE   Homo sapiens mRNA for prepro cortistatin like peptide, complete cds.
XX
SQ   Sequence 368 BP;
     acaagatgcc attgtccccc ggcctcctgc tgctgctgct ctccggggcc acggccaccg        60
     ctgccctgcc cctggagggt ggccccaccg gccgagacag cgagcatatg caggaagcgg       120
     caggaataag gaaaagcagc ctcctgactt tcctcgcttg gtggtttgag tggacctccc       180
     aggccagtgc cgggcccctc ataggagagg aagctcggga ggtggccagg cggcaggaag       240
     gcgcaccccc ccagcaatcc gcgcgccggg acagaatgcc ctgcaggaac ttcttctgga       300
     agaccttctc ctcctgcaaa taaaacctca cccatgaatg ctcacgcaag tttaattaca       360
     gacctgaa                                                                368
//

FASTA format

A sequence file in FASTA format can contain several sequences.
Each sequence in FASTA format begins with a single-line description, followed by lines of sequence data. The description line must begin with a greater-than (">") symbol in the first column.

An example sequence in FASTA format is:

>AB000263 |acc=AB000263|descr=Homo sapiens mRNA for prepro cortistatin like peptide, complete cds.|len=368
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCC
CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGC
CTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGG
AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCC
CTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAG
TTTAATTACAGACCTGAA

GCG format

A sequence file in GCG format contains exactly one sequence, begins with annotation lines and the start of the sequence is marked by a line ending with two dot ("..") characters. This line also contains the sequence identifier, the sequence length and a checksum. This format should only be used if the file was created with the GCG package.

An example sequence in GCG format is:

ID   AB000263 standard; RNA; PRI; 368 BP.
XX
AC   AB000263;
XX
DE   Homo sapiens mRNA for prepro cortistatin like peptide, complete cds.
XX
SQ   Sequence 368 BP;
AB000263  Length: 368  Check: 4514  ..
       1  acaagatgcc attgtccccc ggcctcctgc tgctgctgct ctccggggcc acggccaccg
      61  ctgccctgcc cctggagggt ggccccaccg gccgagacag cgagcatatg caggaagcgg
     121  caggaataag gaaaagcagc ctcctgactt tcctcgcttg gtggtttgag tggacctccc
     181  aggccagtgc cgggcccctc ataggagagg aagctcggga ggtggccagg cggcaggaag
     241  gcgcaccccc ccagcaatcc gcgcgccggg acagaatgcc ctgcaggaac ttcttctgga
     301  agaccttctc ctcctgcaaa taaaacctca cccatgaatg ctcacgcaag tttaattaca
     361  gacctgaa

GCG-RSF (rich sequence format)

The new GCG-RSF can contain several sequences in one file. This format should only be used if the file was created with the GCG package.


GenBank format

A sequence file in GenBank format can contain several sequences.
One sequence in GenBank format starts with a line containing the word LOCUS and a number of annotation lines. The start of the sequence is marked by a line containing "ORIGIN" and the end of the sequence is marked by two slashes ("//").

An example sequence in GenBank format is:

LOCUS       AB000263                 368 bp    mRNA    linear   PRI 05-FEB-1999
DEFINITION  Homo sapiens mRNA for prepro cortistatin like peptide, complete
            cds.
ACCESSION   AB000263
ORIGIN      
        1 acaagatgcc attgtccccc ggcctcctgc tgctgctgct ctccggggcc acggccaccg
       61 ctgccctgcc cctggagggt ggccccaccg gccgagacag cgagcatatg caggaagcgg
      121 caggaataag gaaaagcagc ctcctgactt tcctcgcttg gtggtttgag tggacctccc
      181 aggccagtgc cgggcccctc ataggagagg aagctcggga ggtggccagg cggcaggaag
      241 gcgcaccccc ccagcaatcc gcgcgccggg acagaatgcc ctgcaggaac ttcttctgga
      301 agaccttctc ctcctgcaaa taaaacctca cccatgaatg ctcacgcaag tttaattaca
      361 gacctgaa
//

IG format

A sequence file in IG format can contain several sequences, each consisting of a number of comment lines that must begin with a semicolon (";"), a line with the sequence name (it may not contain spaces!) and the sequence itself terminated with the termination character '1' for linear or '2' for circular sequences.

An example sequence in IG format is:

; comment
; comment
AB000263
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCC
CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGC
CTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGG
AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCC
CTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAG
TTTAATTACAGACCTGAA1

Genomatix annotation syntax

Some Genomatix tools, e.g. Gene2Promoter or GPD allow the extraction of sequences. Genomatix uses the following syntax to annotate sequence information: each information item is denoted by a keyword, followed by a "=" and the value. These information items are separated by a pipe symbol "|".
The keywords are the following:

loc The Genomatix Locus Id, consisting of the string "GXL_" followed by a number.
sym The gene symbol. This can be a (comma-separated) list.
geneid The NCBI Gene Id. This can be a (comma-separated) list.
acc A unique identifier for the sequence. E.g. for Genomatix promoter regions, the Genomatix Promoter Id is listed in this field.
taxid The organism's Taxon Id
spec The organism name
chr The chromosome within the organism.
ctg The NCBI contig within the chromosome.
str Strand, (+) for sense, (-) for antisense strand.
start Start position of the sequence (relative to the contig).
end End position of the sequence (relative to the contig).
len Length of the sequence in basepairs.
tss A (comma-separated list of) UTR-start/TSS position(s). If there are several TSS/UTR-starts, this means that several transcripts share the same promoter (e.g. when they are splice variants). The positions are relative to the promoter region.
probe A (comma-separated list of) Affymetrix Probe Id(s).
unigene A (comma-separated list of) UniGene Cluster Id(s).
homgroup An identifier (a number) for the homology group (available for promoter sequences only). Orthologously related sequences have the same value in this field.
promset If the sequence is a promoter region, the promoter set is denoted here.
descr The gene description. If several genes (i.e. NCBI gene ids) are associated with the sequence, the descriptions for all of the genes are note, separated by ";"
comm A comment field, used for additional annotation. For promoter sequences, this field contains information about the transcripts associated with the promoter. For each transcript the Genomatix Transcript Id, accession number, TSS position and quality is listed, separated by "/". For Genomatix CompGen promoters no transcripts are assigned, in this case the string "CompGen promoter" is denoted.

This syntax is currently used only for sequences in the FASTA and GenBank formats.

Example (a promoter sequence in GenBank format):

LOCUS       GXP_170357    743 bp    DNA
DEFINITION  loc=GXL_141619|sym=TPH2|geneid=121278|acc=GXP_170357|
            taxid=9606|spec=Homo sapiens|chr=12|ctg=NC_000012|str=(+)|
            start=70618393|end=70619135|len=743|tss=501,632|
            homgroup=4612|promset=1|descr=tryptophan hydroxylase 2|
            comm=GXT_2756574/AK094614/632/gold;
            GXT_2799672/NM_173353/501/bronze
ACCESSION   GXP_170357
BASE COUNT    216 a  180 c  147 g  200 t
ORIGIN
        1 TTGATTACCT TATTTGATCA TTACACATTG TACGCTTGTG TCAAAATATC ACATGTGCCT
       61 TATAAATGTG TACAACTATT AGTTATCCAT AAAAATTAAA AATTAAAAAA TCCGTAAAAT
      121 GGTTTAAGCA TTCAGCAGTG CTGATCTTTC TTAAATTATT TTTCTAATTT TGGAAAGAAA
      181 GCACAAAATC TTTGAATTCA CAATTGCTTA AAGACTGAGG TTAACTTGCC AGTGGCAGGC
      241 TTGAGAGATG AGAGAACTAA CGTCAGAGGA TAGATGGTTT CTTGTACAAA TAACACCCCC
      301 TTATGTATTG TTCTCCACCA CCCCCGCCCA AAAAGCTACT CGACCTATGA AACAAATCAC
      361 ACTATGAGCA CAGATAACCC CAGGCTTCAG GTCTGTAATC TGACTGTGGC CATCGGCAAC
      421 CAGAAATGAG TTTCTTTCTA ATCAGTCTTG CATCAGTCTC CAGTCATTCA TATAAAGGAG
      481 CCCGGGGATG GGAGGATTCG CATTGCTCTT CAGCACCAGG GTTCTGGACA GCGCCCCAAG
      541 CAGGCAGCTG ATCGCACGCC CCTTCCTCTC AATCTCCGCC AGCGCTGCTA CTGCCCCTCT
      601 AGTACCCCCT GCTGCAGAGA AAGAATATTA CACCGGGATC CATGCAGCCA GCAATGATGA
      661 TGTTTTCCAG TAAATACTGG GCACGGAGAG GGTTTTCCCT GGATTCAGCA GTGCCCGAAG
      721 AGCATCAGCT ACTTGGCAGC TCA
//
		

IUPAC nucleic acid codes


To represent ambiguity in DNA sequences the following letters can be used (following the rules of the International Union of Pure and Applied Chemistry (IUPAC)):

        A = adenine           
        C = cytosine            
        G = guanine             
        T = thymine           
        U = uracil
        R = G A (purine)        
        Y = T C (pyrimidine)    
        K = G T (keto)    
        M = A C (amino)
        S = G C 
        W = A T 
        B = G T C
        D = G A T
        H = A C T
        V = G C A
        N = A G C T (any)